Transcript: Mouse NM_198667.1

Mus musculus cDNA sequence BC061212 (BC061212), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
BC061212 (381724)
Length:
1625
CDS:
102..1547

Additional Resources:

NCBI RefSeq record:
NM_198667.1
NBCI Gene record:
BC061212 (381724)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264318 CCATCACTCACTACCAAATTT pLKO_005 1009 CDS 100% 15.000 7.500 Y A430089I19Rik n/a
2 TRCN0000184440 GCCTCTCTGGAGTGCTATAAT pLKO.1 1353 CDS 100% 15.000 7.500 Y BC061212 n/a
3 TRCN0000264320 ACCATGCCTTCTGGGACATAT pLKO_005 424 CDS 100% 13.200 6.600 Y A430089I19Rik n/a
4 TRCN0000282992 GAGAAAGGACTCCCTACATTT pLKO_005 617 CDS 100% 13.200 6.600 Y A430089I19Rik n/a
5 TRCN0000264319 GGATACACTAAGGGCAATAAG pLKO_005 1427 CDS 100% 13.200 6.600 Y A430089I19Rik n/a
6 TRCN0000264321 GTGAAGGTCCTTCGCAGATAT pLKO_005 504 CDS 100% 13.200 6.600 Y A430089I19Rik n/a
7 TRCN0000180461 GCCAACTGGAACAAGATGAAT pLKO.1 1317 CDS 100% 5.625 2.813 Y BC061212 n/a
8 TRCN0000179085 CCATGATGAAACACAAGCATA pLKO.1 575 CDS 100% 4.950 2.475 Y BC061212 n/a
9 TRCN0000184437 GCGGTGAACATGGATTCAGAA pLKO.1 1541 CDS 100% 4.950 2.475 Y A430089I19Rik n/a
10 TRCN0000179294 GTTCGTTTCTATCTTCTCCAA pLKO.1 887 CDS 100% 2.640 1.320 Y BC061212 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.