Transcript: Mouse NM_198899.2

Mus musculus UDP-glucose glycoprotein glucosyltransferase 1 (Uggt1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Uggt1 (320011)
Length:
9045
CDS:
176..4831

Additional Resources:

NCBI RefSeq record:
NM_198899.2
NBCI Gene record:
Uggt1 (320011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198899.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110453 CCGAAACCATTATTGTTCAAA pLKO.1 698 CDS 100% 5.625 7.875 N Uggt1 n/a
2 TRCN0000110454 CCAGGATATATTCAGTCTATT pLKO.1 1387 CDS 100% 13.200 10.560 N Uggt1 n/a
3 TRCN0000110451 CCCACATTTAAGGAGTTTATA pLKO.1 4064 CDS 100% 15.000 10.500 N Uggt1 n/a
4 TRCN0000110452 CCAGTAACAATGTTAGGATAA pLKO.1 2535 CDS 100% 10.800 7.560 N Uggt1 n/a
5 TRCN0000004524 CTCTGTTGGATTTGTACCTCA pLKO.1 5004 3UTR 100% 2.640 1.848 N UGGT1 n/a
6 TRCN0000110450 CCTATTGATCTGAGCATTGAT pLKO.1 4938 3UTR 100% 5.625 3.375 N Uggt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198899.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.