Transcript: Human NM_198990.5

Homo sapiens N-acyl phosphatidylethanolamine phospholipase D (NAPEPLD), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
NAPEPLD (222236)
Length:
5039
CDS:
306..1487

Additional Resources:

NCBI RefSeq record:
NM_198990.5
NBCI Gene record:
NAPEPLD (222236)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198990.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078187 GCTATTCCCATCGGAGCTTAT pLKO.1 1218 CDS 100% 10.800 15.120 N NAPEPLD n/a
2 TRCN0000078184 GCAAGTGATTCTTCTAGGTTT pLKO.1 402 CDS 100% 4.950 6.930 N NAPEPLD n/a
3 TRCN0000436621 GCAATTCTTGCTCTATCAAAT pLKO_005 1686 3UTR 100% 13.200 10.560 N NAPEPLD n/a
4 TRCN0000078185 CCCAGTGCTTAAGCCATATTT pLKO.1 617 CDS 100% 15.000 10.500 N NAPEPLD n/a
5 TRCN0000415195 GAAATGGATGAGCTCATATTT pLKO_005 717 CDS 100% 15.000 10.500 N NAPEPLD n/a
6 TRCN0000429417 ACCGAGGTGGTTTATGAAATA pLKO_005 1241 CDS 100% 13.200 9.240 N NAPEPLD n/a
7 TRCN0000429371 ATGACCATCTGGACTACAATT pLKO_005 868 CDS 100% 13.200 9.240 N NAPEPLD n/a
8 TRCN0000078183 CGGACTTAACGCTGAAGATTT pLKO.1 1409 CDS 100% 13.200 9.240 N NAPEPLD n/a
9 TRCN0000435102 TAGACTAGAAGAAGATGTAAC pLKO_005 449 CDS 100% 10.800 7.560 N NAPEPLD n/a
10 TRCN0000078186 CATTGCTTTGAATGAGCGATT pLKO.1 893 CDS 100% 4.050 2.835 N NAPEPLD n/a
11 TRCN0000421452 ATGTTCTCAGATGGCTGATAA pLKO_005 541 CDS 100% 13.200 7.920 N NAPEPLD n/a
12 TRCN0000425156 ACAAGCAGCCAATATCCTAAA pLKO_005 339 CDS 100% 10.800 6.480 N NAPEPLD n/a
13 TRCN0000249629 TCTAGAGAGATACGGACTTTC pLKO_005 1397 CDS 100% 10.800 15.120 N Napepld n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198990.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.