Transcript: Mouse NM_199011.1

Mus musculus diacylglycerol kinase, theta (Dgkq), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Dgkq (110524)
Length:
4612
CDS:
75..2879

Additional Resources:

NCBI RefSeq record:
NM_199011.1
NBCI Gene record:
Dgkq (110524)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360851 GCACTTCGGGCCTACTATATT pLKO_005 1056 CDS 100% 15.000 21.000 N Dgkq n/a
2 TRCN0000025388 CAAGAGGTTCTCCCACTGTTT pLKO.1 1332 CDS 100% 4.950 3.960 N Dgkq n/a
3 TRCN0000360778 ACTGAGGAGGAGGCTAGTAAA pLKO_005 1155 CDS 100% 13.200 9.240 N Dgkq n/a
4 TRCN0000360777 AGGATGGACAGCAGGATTATG pLKO_005 574 CDS 100% 13.200 9.240 N Dgkq n/a
5 TRCN0000360779 GTGGGTAGGTAATGGTCATTA pLKO_005 3031 3UTR 100% 13.200 9.240 N Dgkq n/a
6 TRCN0000025384 CCCAAGATTGTTCAGATGAAT pLKO.1 2259 CDS 100% 5.625 3.938 N Dgkq n/a
7 TRCN0000025386 ACTCCTTACAAGGTGCAGTAA pLKO.1 1657 CDS 100% 4.950 3.465 N Dgkq n/a
8 TRCN0000025385 CAGCAGGATTATGACACGTAT pLKO.1 582 CDS 100% 4.950 3.465 N Dgkq n/a
9 TRCN0000025387 GCTGAGAAAGGCTAAGCAGAA pLKO.1 2786 CDS 100% 4.050 2.835 N Dgkq n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.