Transcript: Mouse NM_199059.2

Mus musculus TATA box binding protein like 2 (Tbpl2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tbpl2 (227606)
Length:
1734
CDS:
61..1113

Additional Resources:

NCBI RefSeq record:
NM_199059.2
NBCI Gene record:
Tbpl2 (227606)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086591 CGGCAGTTCAGTAGCAGTTAT pLKO.1 925 CDS 100% 13.200 18.480 N Tbpl2 n/a
2 TRCN0000425765 GAGCGTTCTGAGATCTATGAA pLKO_005 1045 CDS 100% 5.625 7.875 N Tbpl2 n/a
3 TRCN0000086589 CCTCAATTACAGAATGTAGTT pLKO.1 580 CDS 100% 4.950 3.960 N Tbpl2 n/a
4 TRCN0000426323 AGAGGTTTGCTGCAGTAATAA pLKO_005 677 CDS 100% 15.000 10.500 N Tbpl2 n/a
5 TRCN0000086588 CTGGGCTTCAAGCAATAATTT pLKO.1 1122 3UTR 100% 15.000 10.500 N Tbpl2 n/a
6 TRCN0000431485 CCTTACCTGTGGCATTGATAG pLKO_005 512 CDS 100% 10.800 7.560 N Tbpl2 n/a
7 TRCN0000086590 CCTTTAGACATGCACTCACTT pLKO.1 175 CDS 100% 4.950 3.465 N Tbpl2 n/a
8 TRCN0000086592 GCCTGTAAATTGGATCTGAGA pLKO.1 616 CDS 100% 2.640 1.848 N Tbpl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.