Transcript: Human NM_199189.2

Homo sapiens matrin 3 (MATR3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
MATR3 (9782)
Length:
5604
CDS:
779..3322

Additional Resources:

NCBI RefSeq record:
NM_199189.2
NBCI Gene record:
MATR3 (9782)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199189.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074907 CCCATAATTTGCAGTCTATAT pLKO.1 1017 CDS 100% 13.200 10.560 N MATR3 n/a
2 TRCN0000074906 GAGACCGATCTTGCTAATTTA pLKO.1 2810 CDS 100% 15.000 10.500 N MATR3 n/a
3 TRCN0000293553 TCAGGCCGCAGTGGATTATTA pLKO_005 2119 CDS 100% 15.000 10.500 N MATR3 n/a
4 TRCN0000102417 CCTTCCTCATTATCAGAAATT pLKO.1 3247 CDS 100% 13.200 9.240 N Matr3 n/a
5 TRCN0000293618 GACCTCGCATAACTATCATAA pLKO_005 1492 CDS 100% 13.200 9.240 N MATR3 n/a
6 TRCN0000102419 GCCTTCCTCATTATCAGAAAT pLKO.1 3246 CDS 100% 13.200 9.240 N Matr3 n/a
7 TRCN0000308815 GCCTTCCTCATTATCAGAAAT pLKO_005 3246 CDS 100% 13.200 9.240 N Matr3 n/a
8 TRCN0000293617 TGACTTCCTAAGCTACTTAAG pLKO_005 3566 3UTR 100% 10.800 7.560 N MATR3 n/a
9 TRCN0000074905 GCACTTTAGAAGAGATAGTTT pLKO.1 1324 CDS 100% 5.625 3.938 N MATR3 n/a
10 TRCN0000286101 GCACTTTAGAAGAGATAGTTT pLKO_005 1324 CDS 100% 5.625 3.938 N MATR3 n/a
11 TRCN0000074904 CCATCAGATAAAGCTGTGAAA pLKO.1 2861 CDS 100% 4.950 3.465 N MATR3 n/a
12 TRCN0000286102 CCATCAGATAAAGCTGTGAAA pLKO_005 2861 CDS 100% 4.950 3.465 N MATR3 n/a
13 TRCN0000074903 CCCGTTATCTTTGACCAGTAT pLKO.1 3991 3UTR 100% 4.950 3.465 N MATR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199189.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.