Transcript: Mouse NM_199201.1

Mus musculus CD300 molecule like family member D3 (Cd300ld3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cd300ld3 (382551)
Length:
738
CDS:
1..738

Additional Resources:

NCBI RefSeq record:
NM_199201.1
NBCI Gene record:
Cd300ld3 (382551)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281915 GGAACTGATCCCATGTTTAAA pLKO_005 340 CDS 100% 15.000 7.500 Y Cd300ld5 n/a
2 TRCN0000281856 ACTGGTGCCGAGGAGCTTATT pLKO_005 155 CDS 100% 13.200 6.600 Y Cd300ld4 n/a
3 TRCN0000281914 ATGAGCGATGCTGACATTTAC pLKO_005 298 CDS 100% 13.200 6.600 Y Cd300ld4 n/a
4 TRCN0000100059 CGTGAACATTGACCCAGAAAT pLKO.1 366 CDS 100% 13.200 6.600 Y Cd300ld3 n/a
5 TRCN0000297093 GAACATTGACCCAGAAATTTC pLKO_005 369 CDS 100% 13.200 6.600 Y Cd300ld4 n/a
6 TRCN0000434571 GATGAGCGATGCTGACATTTA pLKO_005 297 CDS 100% 13.200 6.600 Y Cd300ld3 n/a
7 TRCN0000284629 GGATGAGCGATGCTGACATTT pLKO_005 296 CDS 100% 13.200 6.600 Y Cd300ld5 n/a
8 TRCN0000272148 TTGACAGTGCAGTGCAGATAT pLKO_005 106 CDS 100% 13.200 6.600 Y Cd300ld5 n/a
9 TRCN0000436510 ACAGGCCTCAGAGACACTATG pLKO_005 635 CDS 100% 10.800 5.400 Y Cd300ld3 n/a
10 TRCN0000272146 ATGTGAGATTCTCGTTGAAAC pLKO_005 183 CDS 100% 10.800 5.400 Y Cd300ld4 n/a
11 TRCN0000281916 CCAGAAATTTCAACTACAATC pLKO_005 379 CDS 100% 10.800 5.400 Y Cd300ld5 n/a
12 TRCN0000439865 CCTTCTTGCTGATGGTCTTTG pLKO_005 566 CDS 100% 10.800 5.400 Y Cd300ld3 n/a
13 TRCN0000443275 GCATTGGCACAGAGAACATTG pLKO_005 494 CDS 100% 10.800 5.400 Y Cd300ld3 n/a
14 TRCN0000100056 GCCGAGGAGCTTATTGGAAAT pLKO.1 161 CDS 100% 10.800 5.400 Y Cd300ld3 n/a
15 TRCN0000281858 TACTGGTGCCGAGGAGCTTAT pLKO_005 154 CDS 100% 10.800 5.400 Y Cd300ld5 n/a
16 TRCN0000438034 TGACAGTGCAGTGCAGATATG pLKO_005 107 CDS 100% 10.800 5.400 Y Cd300ld3 n/a
17 TRCN0000100058 CATGTGAGATTCTCGTTGAAA pLKO.1 182 CDS 100% 5.625 2.813 Y Cd300ld3 n/a
18 TRCN0000100055 CCCAGAAATTTCAACTACAAT pLKO.1 378 CDS 100% 5.625 2.813 Y Cd300ld3 n/a
19 TRCN0000100057 GCTGGAACTGATCCCATGTTT pLKO.1 337 CDS 100% 5.625 2.813 Y Cd300ld3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.