Transcript: Mouse NM_199251.1

Mus musculus potassium channel, subfamily K, member 12 (Kcnk12), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Kcnk12 (210741)
Length:
1952
CDS:
541..1833

Additional Resources:

NCBI RefSeq record:
NM_199251.1
NBCI Gene record:
Kcnk12 (210741)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069255 CCATAGGTTTCGGCATGACAA pLKO.1 926 CDS 100% 4.950 6.930 N Kcnk12 n/a
2 TRCN0000069257 GTGCGTCAACACGCGACAGAA pLKO.1 1740 CDS 100% 1.650 2.310 N Kcnk12 n/a
3 TRCN0000069256 CCTCTTTCTAGAGCGCATCAT pLKO.1 1026 CDS 100% 4.950 3.465 N Kcnk12 n/a
4 TRCN0000069253 CTGCATCTACTCGCTCTTCAA pLKO.1 1407 CDS 100% 4.950 3.465 N Kcnk12 n/a
5 TRCN0000438609 TACGTGGACTCGCTCTACTTC pLKO_005 1267 CDS 100% 4.950 3.465 N KCNK12 n/a
6 TRCN0000421814 ATCTCGCTGCTGGCCTTCATC pLKO_005 1045 CDS 100% 1.650 1.155 N KCNK12 n/a
7 TRCN0000069254 CCGTGTTCTCTGCGCTCGAAA pLKO.1 704 CDS 100% 1.650 1.155 N Kcnk12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.