Transcript: Mouse NM_199323.3

Mus musculus transforming, acidic coiled-coil containing protein 1 (Tacc1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Tacc1 (320165)
Length:
6581
CDS:
258..1364

Additional Resources:

NCBI RefSeq record:
NM_199323.3
NBCI Gene record:
Tacc1 (320165)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199323.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126703 CGTTGATCAGAGAAGAGATAA pLKO.1 769 CDS 100% 13.200 10.560 N Tacc1 n/a
2 TRCN0000126700 CGAAGCAAATGAATGGAAGAA pLKO.1 803 CDS 100% 4.950 3.960 N Tacc1 n/a
3 TRCN0000126702 CACGTTGATCAGAGAAGAGAT pLKO.1 767 CDS 100% 4.950 3.465 N Tacc1 n/a
4 TRCN0000126701 GCATGAGTTCTCAGAAGAGTT pLKO.1 925 CDS 100% 4.950 3.465 N Tacc1 n/a
5 TRCN0000126699 GCCAAGTGTTTATTGCACATT pLKO.1 6240 3UTR 100% 4.950 3.465 N Tacc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199323.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.