Transcript: Mouse NM_199366.4

Mus musculus galactose-3-O-sulfotransferase 2 (Gal3st2), mRNA.

Source:
NCBI, updated 2016-08-26
Taxon:
Mus musculus (mouse)
Gene:
Gal3st2 (381334)
Length:
2846
CDS:
251..1441

Additional Resources:

NCBI RefSeq record:
NM_199366.4
NBCI Gene record:
Gal3st2 (381334)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199366.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099117 CAGCATTTCAATCGCACGTTT pLKO.1 1097 CDS 100% 4.950 2.475 Y Gal3st2 n/a
2 TRCN0000099118 CCCAAGAACCTGACACACATA pLKO.1 1226 CDS 100% 4.950 2.475 Y Gal3st2 n/a
3 TRCN0000099116 CGATTCCATCTGGTGCTCATT pLKO.1 905 CDS 100% 4.950 2.475 Y Gal3st2 n/a
4 TRCN0000099115 CCAGCATTTCAATCGCACGTT pLKO.1 1096 CDS 100% 2.640 1.320 Y Gal3st2 n/a
5 TRCN0000099119 CAGACTACTTCGATGAGTCTA pLKO.1 927 CDS 100% 0.495 0.248 Y Gal3st2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199366.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.