Transcript: Human NM_199420.4

Homo sapiens DNA polymerase theta (POLQ), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
POLQ (10721)
Length:
8757
CDS:
112..7884

Additional Resources:

NCBI RefSeq record:
NM_199420.4
NBCI Gene record:
POLQ (10721)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199420.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052998 CGGGCCTCTTTAGATATAAAT pLKO.1 3082 CDS 100% 15.000 21.000 N POLQ n/a
2 TRCN0000290547 CGGGCCTCTTTAGATATAAAT pLKO_005 3082 CDS 100% 15.000 21.000 N POLQ n/a
3 TRCN0000053001 GCTGACCAAGATTTGCTATAT pLKO.1 810 CDS 100% 13.200 9.240 N POLQ n/a
4 TRCN0000290550 GCTGACCAAGATTTGCTATAT pLKO_005 810 CDS 100% 13.200 9.240 N POLQ n/a
5 TRCN0000053002 CCCTGTTACATTCTAGTACAT pLKO.1 2816 CDS 100% 4.950 3.465 N POLQ n/a
6 TRCN0000290549 CCCTGTTACATTCTAGTACAT pLKO_005 2816 CDS 100% 4.950 3.465 N POLQ n/a
7 TRCN0000053000 CGTCGTCTCATTCAAGTGTTA pLKO.1 7147 CDS 100% 4.950 3.465 N POLQ n/a
8 TRCN0000290548 CGTCGTCTCATTCAAGTGTTA pLKO_005 7147 CDS 100% 4.950 3.465 N POLQ n/a
9 TRCN0000052999 CCTTCAATCTTGCTTGCGAAA pLKO.1 5952 CDS 100% 4.050 2.835 N POLQ n/a
10 TRCN0000290546 CCTTCAATCTTGCTTGCGAAA pLKO_005 5952 CDS 100% 4.050 2.835 N POLQ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199420.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.