Transcript: Human NM_199450.2

Homo sapiens zinc finger protein 365 (ZNF365), transcript variant B, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
ZNF365 (22891)
Length:
1726
CDS:
316..1317

Additional Resources:

NCBI RefSeq record:
NM_199450.2
NBCI Gene record:
ZNF365 (22891)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412657 AGTCTGCGATTGTGGAATAAT pLKO_005 1298 CDS 100% 15.000 21.000 N ZNF365 n/a
2 TRCN0000131181 GAGAATCTGTTACAGCGGGTA pLKO.1 1141 CDS 100% 2.160 3.024 N ZNF365 n/a
3 TRCN0000420139 TGGATCAAGAGAATCGCAAAT pLKO_005 1352 3UTR 100% 10.800 8.640 N ZNF365 n/a
4 TRCN0000130088 CTACGAAGAAAGAACCCTCTT pLKO.1 471 CDS 100% 4.050 3.240 N ZNF365 n/a
5 TRCN0000128835 GCAGAAACCGAGCTATGTTAA pLKO.1 594 CDS 100% 13.200 9.240 N ZNF365 n/a
6 TRCN0000427283 CAGAGAAGCTTTCATTCATTC pLKO_005 1382 3UTR 100% 10.800 7.560 N ZNF365 n/a
7 TRCN0000414970 GTCTCTTTCCATCCCTCAAAG pLKO_005 503 CDS 100% 10.800 7.560 N ZNF365 n/a
8 TRCN0000438600 CCTATGTGCAGACCTACACTG pLKO_005 686 CDS 100% 4.050 2.835 N ZNF365 n/a
9 TRCN0000128526 CTTTACAAGAAACTTGGGCTA pLKO.1 1440 3UTR 100% 2.160 1.512 N ZNF365 n/a
10 TRCN0000128726 CAGGAGTCCTTTGAGAATGTT pLKO.1 355 CDS 100% 5.625 3.375 N ZNF365 n/a
11 TRCN0000128973 GAGGAGCTTCTTAGGAAAGAA pLKO.1 1036 CDS 100% 0.563 0.338 N ZNF365 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.