Transcript: Human NM_199451.3

Homo sapiens zinc finger protein 365 (ZNF365), transcript variant C, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ZNF365 (22891)
Length:
3201
CDS:
104..1492

Additional Resources:

NCBI RefSeq record:
NM_199451.3
NBCI Gene record:
ZNF365 (22891)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199451.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000131181 GAGAATCTGTTACAGCGGGTA pLKO.1 929 CDS 100% 2.160 3.024 N ZNF365 n/a
2 TRCN0000130088 CTACGAAGAAAGAACCCTCTT pLKO.1 259 CDS 100% 4.050 3.240 N ZNF365 n/a
3 TRCN0000128835 GCAGAAACCGAGCTATGTTAA pLKO.1 382 CDS 100% 13.200 9.240 N ZNF365 n/a
4 TRCN0000414970 GTCTCTTTCCATCCCTCAAAG pLKO_005 291 CDS 100% 10.800 7.560 N ZNF365 n/a
5 TRCN0000438600 CCTATGTGCAGACCTACACTG pLKO_005 474 CDS 100% 4.050 2.835 N ZNF365 n/a
6 TRCN0000128726 CAGGAGTCCTTTGAGAATGTT pLKO.1 143 CDS 100% 5.625 3.375 N ZNF365 n/a
7 TRCN0000128973 GAGGAGCTTCTTAGGAAAGAA pLKO.1 824 CDS 100% 0.563 0.338 N ZNF365 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199451.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.