Transcript: Mouse NM_199470.2

Mus musculus cadherin-like 24 (Cdh24), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cdh24 (239096)
Length:
2728
CDS:
262..2607

Additional Resources:

NCBI RefSeq record:
NM_199470.2
NBCI Gene record:
Cdh24 (239096)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199470.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094809 CCCTACCTGATTCCTATCGAA pLKO.1 1912 CDS 100% 3.000 4.200 N Cdh24 n/a
2 TRCN0000094813 CGCTCTTACACCTTCCGTGTA pLKO.1 1255 CDS 100% 0.405 0.567 N Cdh24 n/a
3 TRCN0000094810 CCCATCGGAGTTCATCATCAA pLKO.1 657 CDS 100% 4.950 3.960 N Cdh24 n/a
4 TRCN0000436415 CAAGTTCCCTCAGAGTCTATA pLKO_005 1032 CDS 100% 13.200 9.240 N Cdh24 n/a
5 TRCN0000430441 CTTTGTCATTGAGGAATATTC pLKO_005 414 CDS 100% 13.200 9.240 N Cdh24 n/a
6 TRCN0000094812 CCCTATGACATCTTTGTATGT pLKO.1 1705 CDS 100% 4.950 3.465 N Cdh24 n/a
7 TRCN0000094811 GAGATGAAGTTGGCAACAGTA pLKO.1 1775 CDS 100% 4.950 3.465 N Cdh24 n/a
8 TRCN0000364932 ATGAGGCCACAGGCAATATTC pLKO_005 545 CDS 100% 13.200 9.240 N CDH24 n/a
9 TRCN0000364935 TCTTTGTCATTGAGGAATATG pLKO_005 413 CDS 100% 13.200 9.240 N CDH24 n/a
10 TRCN0000054252 CTTCAGCATCAGCACAGACTT pLKO.1 1179 CDS 100% 4.950 3.465 N CDH24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199470.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.