Transcript: Human NM_201278.3

Homo sapiens myotubularin related protein 2 (MTMR2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
MTMR2 (8898)
Length:
4689
CDS:
564..2279

Additional Resources:

NCBI RefSeq record:
NM_201278.3
NBCI Gene record:
MTMR2 (8898)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201278.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382205 TATCGAACCATCCGAGGATTT pLKO_005 1662 CDS 100% 10.800 15.120 N MTMR2 n/a
2 TRCN0000003011 GAACGATATGAACTTTGTGAT pLKO.1 1041 CDS 100% 4.950 6.930 N MTMR2 n/a
3 TRCN0000293494 GAACGATATGAACTTTGTGAT pLKO_005 1041 CDS 100% 4.950 6.930 N MTMR2 n/a
4 TRCN0000293427 GTAGAAAGTCTTCGGAATTTA pLKO_005 2341 3UTR 100% 15.000 12.000 N MTMR2 n/a
5 TRCN0000003010 GACTTCACTAATCCTCTCTAT pLKO.1 1995 CDS 100% 4.950 3.960 N MTMR2 n/a
6 TRCN0000003009 CGGCCAAGTGTTAATGCTGTT pLKO.1 1311 CDS 100% 4.050 3.240 N MTMR2 n/a
7 TRCN0000306718 CGGCCAAGTGTTAATGCTGTT pLKO_005 1311 CDS 100% 4.050 3.240 N MTMR2 n/a
8 TRCN0000380304 AGAGCTCTGGGTGGGATATTA pLKO_005 2066 CDS 100% 15.000 10.500 N MTMR2 n/a
9 TRCN0000293425 GTCACGAATTATAGGTTATAT pLKO_005 666 CDS 100% 15.000 10.500 N MTMR2 n/a
10 TRCN0000293426 GCGGACAAGAAGATCCATATT pLKO_005 854 CDS 100% 13.200 9.240 N MTMR2 n/a
11 TRCN0000003013 CCCTTGTGACTAATTCCTATT pLKO.1 4448 3UTR 100% 10.800 7.560 N MTMR2 n/a
12 TRCN0000003012 CATTTCAACTTCTGCCGACAA pLKO.1 371 5UTR 100% 4.050 2.835 N MTMR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201278.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.