Transcript: Mouse NM_201358.2

Mus musculus LYR motif containing 4 (Lyrm4), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Lyrm4 (380840)
Length:
1515
CDS:
198..473

Additional Resources:

NCBI RefSeq record:
NM_201358.2
NBCI Gene record:
Lyrm4 (380840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_201358.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250937 ATCCGCAGACAGGTCCATATT pLKO_005 393 CDS 100% 13.200 18.480 N Lyrm4 n/a
2 TRCN0000250940 CCGCCACTCAAACCTACAAAT pLKO_005 1008 3UTR 100% 13.200 18.480 N Lyrm4 n/a
3 TRCN0000250938 AGCATTTCAGCGCCTACAATT pLKO_005 259 CDS 100% 13.200 9.240 N Lyrm4 n/a
4 TRCN0000258094 ATACTCAACTGACAAGCTTAT pLKO_005 422 CDS 100% 10.800 7.560 N Lyrm4 n/a
5 TRCN0000191471 CCAACTATACTCAACTGACAA pLKO.1 416 CDS 100% 4.950 3.465 N Lyrm4 n/a
6 TRCN0000200915 CAGGAGAATAAGAGATGCCTT pLKO.1 296 CDS 100% 2.640 1.848 N Lyrm4 n/a
7 TRCN0000250939 CAAGAGAAGCCCAGGACATAG pLKO_005 453 CDS 100% 10.800 6.480 N Lyrm4 n/a
8 TRCN0000007244 GCTGATAAACTGAGTCCCAAA pLKO.1 592 3UTR 100% 4.050 2.430 N HERC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201358.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.