Transcript: Mouse NM_201364.1

Mus musculus cDNA sequence BC055324 (BC055324), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
BC055324 (381306)
Length:
2930
CDS:
62..2773

Additional Resources:

NCBI RefSeq record:
NM_201364.1
NBCI Gene record:
BC055324 (381306)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_201364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246492 TCAAACACCACTCGGTTATAA pLKO_005 804 CDS 100% 15.000 21.000 N BC055324 n/a
2 TRCN0000246496 ATGTCCTGACTTCGGTGATTA pLKO_005 2166 CDS 100% 13.200 18.480 N BC055324 n/a
3 TRCN0000215483 GGATTGAACATATCCGAATTT pLKO.1 198 CDS 100% 13.200 18.480 N BC055324 n/a
4 TRCN0000246494 TGATAATGGTAGGAGTTATTC pLKO_005 696 CDS 100% 13.200 18.480 N BC055324 n/a
5 TRCN0000246495 TTGCATTTGTGGCAGTATATT pLKO_005 1796 CDS 100% 15.000 12.000 N BC055324 n/a
6 TRCN0000184696 CGGCTCCTCTCTATGTATCAA pLKO.1 164 CDS 100% 5.625 4.500 N BC055324 n/a
7 TRCN0000217109 CAAACACCACTCGGTTATAAA pLKO.1 805 CDS 100% 15.000 10.500 N BC055324 n/a
8 TRCN0000246493 ATGCTGACTACAGGTTATTTC pLKO_005 939 CDS 100% 13.200 9.240 N BC055324 n/a
9 TRCN0000179457 GAGTACCTCTTTGTTAGCGAT pLKO.1 1567 CDS 100% 2.640 1.848 N BC055324 n/a
10 TRCN0000179484 GCTCTATTGAATGCTGTGCTT pLKO.1 1535 CDS 100% 2.640 1.848 N BC055324 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.