Transcript: Mouse NM_201640.3

Mus musculus cytochrome P450, family 4, subfamily a, polypeptide 31 (Cyp4a31), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Cyp4a31 (666168)
Length:
2509
CDS:
69..1598

Additional Resources:

NCBI RefSeq record:
NM_201640.3
NBCI Gene record:
Cyp4a31 (666168)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_201640.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262075 CCCATGTCCTTAGCCCGATTT pLKO_005 1527 CDS 100% 10.800 7.560 N Cyp4a31 n/a
2 TRCN0000262073 TTTCATCAGAATGATACTATC pLKO_005 771 CDS 100% 10.800 6.480 N Cyp4a31 n/a
3 TRCN0000191384 CAGGAAATTGTGTCATGCATA pLKO.1 282 CDS 100% 4.950 2.970 N Cyp4a31 n/a
4 TRCN0000262074 TTCGATTGATGCTAGACAAAT pLKO_005 562 CDS 100% 13.200 6.600 Y Cyp4a31 n/a
5 TRCN0000282078 CAGCCTTCCACTATGACATTC pLKO_005 508 CDS 100% 10.800 5.400 Y Cyp4a31 n/a
6 TRCN0000262076 GTTCAGTATAGATCATCATTC pLKO_005 2099 3UTR 100% 10.800 5.400 Y Cyp4a31 n/a
7 TRCN0000125891 CCCTGACTACATGAAAGTGAT pLKO.1 368 CDS 100% 4.950 2.475 Y Cyp4a10 n/a
8 TRCN0000125890 CCTGACTACATGAAAGTGATT pLKO.1 369 CDS 100% 4.950 2.475 Y Cyp4a10 n/a
9 TRCN0000191430 CCTGACTACATGAAAGTGATT pLKO.1 369 CDS 100% 4.950 2.475 Y Cyp4a31 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1762 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201640.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.