Transcript: Mouse NM_203319.1

Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 37 (Dhx37), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Dhx37 (208144)
Length:
4235
CDS:
12..3464

Additional Resources:

NCBI RefSeq record:
NM_203319.1
NBCI Gene record:
Dhx37 (208144)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_203319.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113022 CCGCTACAAATACTTTGCAAA pLKO.1 3167 CDS 100% 4.950 6.930 N Dhx37 n/a
2 TRCN0000113023 GCCTACAAGACTCCTCTTCTA pLKO.1 2850 CDS 100% 4.950 3.960 N Dhx37 n/a
3 TRCN0000113021 GCTGAAATACAAGGTGGTGAT pLKO.1 1088 CDS 100% 4.050 2.835 N Dhx37 n/a
4 TRCN0000113024 CAGTGGTGAATGCTTCAGGAA pLKO.1 1355 CDS 100% 2.640 1.848 N Dhx37 n/a
5 TRCN0000113020 CCCTTCTTTGTGACTGTTATA pLKO.1 3586 3UTR 100% 13.200 7.920 N Dhx37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203319.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.