Transcript: Human NM_203364.3

Homo sapiens cell cycle associated protein 1 (CAPRIN1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CAPRIN1 (4076)
Length:
3505
CDS:
142..2226

Additional Resources:

NCBI RefSeq record:
NM_203364.3
NBCI Gene record:
CAPRIN1 (4076)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_203364.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115976 CGCCCTTCATTCTCTAACACT pLKO.1 2059 CDS 100% 3.000 2.400 N CAPRIN1 n/a
2 TRCN0000333560 CGCCCTTCATTCTCTAACACT pLKO_005 2059 CDS 100% 3.000 2.400 N CAPRIN1 n/a
3 TRCN0000115975 CCTCAGCAGAACACTGGATTT pLKO.1 1912 CDS 100% 10.800 7.560 N CAPRIN1 n/a
4 TRCN0000291154 CCTCAGCAGAACACTGGATTT pLKO_005 1912 CDS 100% 10.800 7.560 N CAPRIN1 n/a
5 TRCN0000115974 GCCAGTTATAACCAGAGCTTT pLKO.1 1768 CDS 100% 4.950 3.465 N CAPRIN1 n/a
6 TRCN0000291097 GCCAGTTATAACCAGAGCTTT pLKO_005 1768 CDS 100% 4.950 3.465 N CAPRIN1 n/a
7 TRCN0000102224 CCCTATAATTTCATACAGGAT pLKO.1 1246 CDS 100% 2.640 1.848 N Caprin1 n/a
8 TRCN0000115973 GCCGTTTCTAAGTACCAGGAA pLKO.1 424 CDS 100% 2.640 1.848 N CAPRIN1 n/a
9 TRCN0000291096 GCCGTTTCTAAGTACCAGGAA pLKO_005 424 CDS 100% 2.640 1.848 N CAPRIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203364.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.