Transcript: Human NM_203434.3

Homo sapiens immediate early response 5 like (IER5L), mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
IER5L (389792)
Length:
2710
CDS:
210..1424

Additional Resources:

NCBI RefSeq record:
NM_203434.3
NBCI Gene record:
IER5L (389792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_203434.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257442 GACGCGTCCAACATCTCAAAC pLKO_005 1254 CDS 100% 10.800 15.120 N IER5L n/a
2 TRCN0000257444 GACGCGTCCAACATCTCAAAC pLKO_005 1254 CDS 100% 10.800 15.120 N Ier5l n/a
3 TRCN0000244694 TCGAGCCATTGTCGCCTTCTA pLKO_005 1403 CDS 100% 4.950 3.960 N IER5L n/a
4 TRCN0000345860 TCGAGCCATTGTCGCCTTCTA pLKO_005 1403 CDS 100% 4.950 3.960 N Ier5l n/a
5 TRCN0000257424 AGGGACGTTTGGGTCACATTT pLKO_005 1963 3UTR 100% 13.200 9.240 N IER5L n/a
6 TRCN0000244692 CGGCTGCAAGCGCAAGTATTA pLKO_005 1103 CDS 100% 13.200 9.240 N IER5L n/a
7 TRCN0000179424 CCAACATCTCAAACTTGATCT pLKO.1 1261 CDS 100% 4.950 3.465 N Ier5l n/a
8 TRCN0000244693 ACCTAGACACTCACGTGGTGA pLKO_005 982 CDS 100% 2.640 1.848 N IER5L n/a
9 TRCN0000250610 CGGCATCAAGCTGCACAAGAA pLKO_005 287 CDS 100% 4.950 2.970 N Ier5l n/a
10 TRCN0000179425 CATCTCAAACTTGATCTCCAT pLKO.1 1265 CDS 100% 2.640 1.584 N Ier5l n/a
11 TRCN0000195999 CAAGCTGCACAAGAACCTCTT pLKO.1 293 CDS 100% 4.050 2.430 N Ier5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203434.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.