Transcript: Mouse NM_203508.1

Mus musculus epididymal protein 3B (Eddm3b), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Eddm3b (219026)
Length:
1272
CDS:
23..472

Additional Resources:

NCBI RefSeq record:
NM_203508.1
NBCI Gene record:
Eddm3b (219026)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_203508.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106308 GATGGGTATGTCGACAGCATA pLKO.1 419 CDS 100% 4.950 6.930 N Eddm3b n/a
2 TRCN0000106306 GCTCTCACACATGTTTGTTTA pLKO.1 220 CDS 100% 13.200 9.240 N Eddm3b n/a
3 TRCN0000106307 CCATCACCTGAGTCCAAACAA pLKO.1 142 CDS 100% 5.625 3.938 N Eddm3b n/a
4 TRCN0000106305 GCTCTCTGCTACTGTGACAAA pLKO.1 786 3UTR 100% 4.950 3.465 N Eddm3b n/a
5 TRCN0000106309 CATGACAGATAAAGCCGTGAA pLKO.1 193 CDS 100% 4.050 2.835 N Eddm3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203508.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.