Transcript: Mouse NM_206535.1

Mus musculus Cd200 receptor 2 (Cd200r2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cd200r2 (271375)
Length:
1750
CDS:
214..963

Additional Resources:

NCBI RefSeq record:
NM_206535.1
NBCI Gene record:
Cd200r2 (271375)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_206535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112622 TCCTGCATAATGGCCTACAAA pLKO.1 391 CDS 100% 5.625 3.938 N Cd200r2 n/a
2 TRCN0000112621 GCCGTTCTATTCCACTGACAA pLKO.1 326 CDS 100% 4.950 3.465 N Cd200r2 n/a
3 TRCN0000112623 AGTAGAAACAAAGGAGACCAA pLKO.1 411 CDS 100% 2.640 1.848 N Cd200r2 n/a
4 TRCN0000112624 CATAAAGTCTATGACCTCCAA pLKO.1 565 CDS 100% 2.640 1.848 N Cd200r2 n/a
5 TRCN0000112620 GCTCCTGTCTAAAGGAAATAT pLKO.1 1112 3UTR 100% 15.000 7.500 Y Cd200r2 n/a
6 TRCN0000112615 CCTGCTGTCTTCATGTTTGTT pLKO.1 1058 3UTR 100% 5.625 2.813 Y Cd200r4 n/a
7 TRCN0000112628 GCAGTATTAATCACATGGATA pLKO.1 349 CDS 100% 4.950 2.475 Y F630003A18Rik n/a
8 TRCN0000112618 GCTTTCTTCCAGAAGAGAAAT pLKO.1 928 CDS 100% 1.320 0.660 Y Cd200r4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.