Transcript: Mouse NM_206870.1

Mus musculus interferon alpha 15 (Ifna15), mRNA.

Source:
NCBI, updated 2018-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ifna15 (242517)
Length:
573
CDS:
1..573

Additional Resources:

NCBI RefSeq record:
NM_206870.1
NBCI Gene record:
Ifna15 (242517)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_206870.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066128 TCCCTGTCCTACAAGAGCTGA pLKO.1 230 CDS 100% 2.640 1.848 N Ifna15 n/a
2 TRCN0000066129 CAGCAGATCCAGAATGCTCAA pLKO.1 205 CDS 100% 4.050 2.430 N Ifna15 n/a
3 TRCN0000065473 CCTGAACATCTTCACATCAAA pLKO.1 261 CDS 100% 5.625 2.813 Y Ifna1 n/a
4 TRCN0000065779 GCTGGCTGTGAGGACATACTT pLKO.1 420 CDS 100% 5.625 2.813 Y Ifna7 n/a
5 TRCN0000065881 CAGCAGCTCAATGACCTCAAA pLKO.1 340 CDS 100% 4.950 2.475 Y Ifna5 n/a
6 TRCN0000066132 TCTTCACATCAAAGGACTCAT pLKO.1 269 CDS 100% 4.950 2.475 Y Ifna15 n/a
7 TRCN0000066131 TGACCTCAAAGCCTGTGTGAT pLKO.1 351 CDS 100% 4.950 2.475 Y Ifna15 n/a
8 TRCN0000065576 CCTGAAGGACAGAAAGGACTT pLKO.1 156 CDS 100% 4.050 2.025 Y Ifna6 n/a
9 TRCN0000433507 GGATCACTGTGTACCTGAGAG pLKO_005 446 CDS 100% 4.050 2.025 Y Ifna1 n/a
10 TRCN0000065782 CAAAGGACTCATCTGCTGCTT pLKO.1 278 CDS 100% 2.640 1.320 Y Ifna7 n/a
11 TRCN0000066130 CCTCAGGAACAAGAGAGCCTT pLKO.1 93 CDS 100% 2.640 1.320 Y Ifna15 n/a
12 TRCN0000065475 CCTCCTAGACTCATTCTGCAA pLKO.1 309 CDS 100% 2.640 1.320 Y Ifna1 n/a
13 TRCN0000065537 CCTGGTACAAATGAGGAGACT pLKO.1 120 CDS 100% 2.640 1.320 Y Ifnab n/a
14 TRCN0000065577 GAGGACATACTTCCACAGGAT pLKO.1 429 CDS 100% 2.640 1.320 Y Ifna6 n/a
15 TRCN0000065536 TCAGACTCATAACCTCAGGAA pLKO.1 81 CDS 100% 2.640 1.320 Y Ifnab n/a
16 TRCN0000100991 CCTAGACTCATTCTGCAATGA pLKO.1 312 CDS 100% 0.495 0.248 Y Ifna6 n/a
17 TRCN0000100992 TCATAACCTCAGGAACAAGAA pLKO.1 87 CDS 100% 4.950 2.475 Y Ifna6 n/a
18 TRCN0000065575 CTCAGGAACAAGAGAGCCTTA pLKO.1 94 CDS 100% 4.050 2.025 Y Ifna6 n/a
19 TRCN0000100993 CAAAGGACTCATCTGCTGCAT pLKO.1 278 CDS 100% 2.640 1.320 Y Ifna6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206870.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.