Transcript: Human NM_206999.3

Homo sapiens CCR4-NOT transcription complex subunit 1 (CNOT1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-19
Taxon:
Homo sapiens (human)
Gene:
CNOT1 (23019)
Length:
5161
CDS:
274..4929

Additional Resources:

NCBI RefSeq record:
NM_206999.3
NBCI Gene record:
CNOT1 (23019)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_206999.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285484 CAGCTATTTCCAGCGAATATA pLKO_005 2820 CDS 100% 15.000 12.000 N CNOT1 n/a
2 TRCN0000276067 CATTCAACATTCCCTTATAAA pLKO_005 1497 CDS 100% 15.000 10.500 N CNOT1 n/a
3 TRCN0000136340 GCCAAATTGTCTCGAATACTT pLKO.1 1936 CDS 100% 5.625 3.938 N CNOT1 n/a
4 TRCN0000276068 GCCAAATTGTCTCGAATACTT pLKO_005 1936 CDS 100% 5.625 3.938 N CNOT1 n/a
5 TRCN0000276071 TGCCTATTTGGTGGTATAATT pLKO_005 3016 CDS 100% 15.000 9.000 N CNOT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206999.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.