Transcript: Mouse NM_207008.2

Mus musculus olfactory receptor 773 (Olfr773), mRNA.

Source:
NCBI, updated 2012-08-29
Taxon:
Mus musculus (mouse)
Gene:
Olfr773 (257664)
Length:
936
CDS:
1..936

Additional Resources:

NCBI RefSeq record:
NM_207008.2
NBCI Gene record:
Olfr773 (257664)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207008.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185396 GCTGTACTGACACTCATTATA pLKO.1 598 CDS 100% 15.000 7.500 Y Olfr773 n/a
2 TRCN0000202871 CCATGTACTATTTCCTTAAGA pLKO.1 164 CDS 100% 5.625 2.813 Y Olfr772 n/a
3 TRCN0000202828 CCCAGATACCTGTATAACATA pLKO.1 226 CDS 100% 5.625 2.813 Y Olfr773 n/a
4 TRCN0000203142 GCAGGTTCTTATCTTTATCAT pLKO.1 60 CDS 100% 5.625 2.813 Y Olfr773 n/a
5 TRCN0000184937 CTGCATCTTCATCTACATCAA pLKO.1 753 CDS 100% 4.950 2.475 Y Olfr772 n/a
6 TRCN0000189415 CCATGTCCTATGACCGCTATA pLKO.1 341 CDS 100% 10.800 5.400 Y Olfr814 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207008.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.