Transcript: Mouse NM_207154.2

Mus musculus olfactory receptor 1102 (Olfr1102), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Olfr1102 (228228)
Length:
1063
CDS:
40..1014

Additional Resources:

NCBI RefSeq record:
NM_207154.2
NBCI Gene record:
Olfr1102 (228228)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207154.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185627 GTTGGTCAATTTCCTTTCAAA pLKO.1 318 CDS 100% 5.625 3.938 N Olfr1102 n/a
2 TRCN0000203390 CCAAGTTCCAACTACACACTT pLKO.1 859 CDS 100% 4.950 3.465 N Olfr1102 n/a
3 TRCN0000186617 GCAACACAGATGCTTCTCTTT pLKO.1 367 CDS 100% 4.950 3.465 N Olfr1102 n/a
4 TRCN0000184843 CTTCCTATACTGGTGGAATTT pLKO.1 515 CDS 100% 13.200 7.920 N Olfr1102 n/a
5 TRCN0000202706 CCACTCATTATTGCTTCCTAT pLKO.1 502 CDS 100% 4.950 2.970 N Olfr1102 n/a
6 TRCN0000188942 GCCCACTTCTGTATGCAGTAA pLKO.1 458 CDS 100% 4.950 2.970 N Olfr1102 n/a
7 TRCN0000186827 GCAATGGCTTATGACCGTTAT pLKO.1 424 CDS 100% 10.800 5.400 Y Olfr1102 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207154.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.