Transcript: Human NM_207174.1

Homo sapiens ATP binding cassette subfamily G member 1 (ABCG1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
ABCG1 (9619)
Length:
2983
CDS:
75..2108

Additional Resources:

NCBI RefSeq record:
NM_207174.1
NBCI Gene record:
ABCG1 (9619)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207174.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420317 AGGTGGTCTCGCTGATGAAAG pLKO_005 868 CDS 100% 10.800 8.640 N ABCG1 n/a
2 TRCN0000153440 CTTGTGCCATATTTGAGGGAT pLKO.1 1017 CDS 100% 2.640 2.112 N ABCG1 n/a
3 TRCN0000413386 TGGTGAGTTGGTGGCCATTAT pLKO_005 437 CDS 100% 13.200 9.240 N ABCG1 n/a
4 TRCN0000152596 GTCTGCAATCTTGTGCCATAT pLKO.1 1008 CDS 100% 10.800 7.560 N ABCG1 n/a
5 TRCN0000420907 TAGGAAGATGTAGGCAGATTG pLKO_005 2316 3UTR 100% 10.800 7.560 N ABCG1 n/a
6 TRCN0000153863 CATGCCTACTGTTCTGACATT pLKO.1 1481 CDS 100% 4.950 3.465 N ABCG1 n/a
7 TRCN0000158395 CCTACAGTGGATGTCCTACAT pLKO.1 1847 CDS 100% 4.950 3.465 N ABCG1 n/a
8 TRCN0000151202 GAAGTTCAATAGTGGTGAGTT pLKO.1 425 CDS 100% 4.950 3.465 N ABCG1 n/a
9 TRCN0000156509 GACTTCATCGTACTCGGGATT pLKO.1 2022 CDS 100% 4.050 2.835 N ABCG1 n/a
10 TRCN0000152620 GCTGAAGAATGATTCAGGGTA pLKO.1 2683 3UTR 100% 0.264 0.158 N ABCG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207174.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.