Transcript: Mouse NM_207232.2

Mus musculus protein tyrosine phosphatase domain containing 1 (Ptpdc1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ptpdc1 (218232)
Length:
4429
CDS:
303..2546

Additional Resources:

NCBI RefSeq record:
NM_207232.2
NBCI Gene record:
Ptpdc1 (218232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220922 GTGTGCTAATAGCATGTTATT pLKO.1 895 CDS 100% 13.200 18.480 N Ptpdc1 n/a
2 TRCN0000220919 GCAAGCCATTAAGGGAGTATA pLKO.1 527 CDS 100% 13.200 10.560 N Ptpdc1 n/a
3 TRCN0000220920 GCTGGAGAAGTATCGCATCAT pLKO.1 602 CDS 100% 4.950 3.960 N Ptpdc1 n/a
4 TRCN0000220921 CCAACTTCACAAGTATCCATA pLKO.1 1819 CDS 100% 4.950 3.465 N Ptpdc1 n/a
5 TRCN0000220918 CCTGGCAAACTTAAATGAGTT pLKO.1 2078 CDS 100% 4.950 3.465 N Ptpdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.