Transcript: Mouse NM_207245.2

Mus musculus zinc finger protein 870 (Zfp870), mRNA.

Source:
NCBI, updated 2017-05-02
Taxon:
Mus musculus (mouse)
Gene:
Zfp870 (240066)
Length:
5321
CDS:
161..1846

Additional Resources:

NCBI RefSeq record:
NM_207245.2
NBCI Gene record:
Zfp870 (240066)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207245.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095677 CCAATTCATAGTAGAGCAGAA pLKO.1 1808 CDS 100% 4.050 3.240 N Zfp870 n/a
2 TRCN0000095678 AGCGTTAAGAAGCCCTATGTA pLKO.1 809 CDS 100% 5.625 3.938 N Zfp870 n/a
3 TRCN0000095675 GCGTTAAGAAGCCCTATGTAT pLKO.1 810 CDS 100% 5.625 3.938 N Zfp870 n/a
4 TRCN0000095676 CCTTATGAAGACCAAGAACAT pLKO.1 542 CDS 100% 4.950 3.465 N Zfp870 n/a
5 TRCN0000095674 CCCAATTAAATGCCTTCTCTT pLKO.1 2494 3UTR 100% 4.950 2.970 N Zfp870 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207245.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.