Transcript: Mouse NM_207272.2

Mus musculus TD and POZ domain containing 4 (Tdpoz4), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Tdpoz4 (399675)
Length:
1113
CDS:
1..1113

Additional Resources:

NCBI RefSeq record:
NM_207272.2
NBCI Gene record:
Tdpoz4 (399675)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207272.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239493 ATGGAGGAGAGACTAACAAAC pLKO_005 661 CDS 100% 10.800 6.480 N Gm5541 n/a
2 TRCN0000239495 CTAACACCAGATGACAAATTT pLKO_005 409 CDS 100% 15.000 7.500 Y Gm5541 n/a
3 TRCN0000239494 TGAGGAAACGGAGGAATATAT pLKO_005 99 CDS 100% 15.000 7.500 Y Gm5541 n/a
4 TRCN0000239492 ACGTGTCACTTTATCTGATTT pLKO_005 212 CDS 100% 13.200 6.600 Y Gm5541 n/a
5 TRCN0000197531 CAAAGATTACGTGTCACTTTA pLKO.1 204 CDS 100% 13.200 6.600 Y Tdpoz4 n/a
6 TRCN0000198137 CACAGAGCCATGAACAGAAAT pLKO.1 38 CDS 100% 13.200 6.600 Y Tdpoz4 n/a
7 TRCN0000239491 GTTCGAGGTTTGTATCTTAAA pLKO_005 267 CDS 100% 13.200 6.600 Y Gm5541 n/a
8 TRCN0000177024 GTGTTCTCATTAGAGGACAAT pLKO.1 130 CDS 100% 4.950 2.475 Y Tdpoz4 n/a
9 TRCN0000197560 CCATGAACAGAAATTGTGCTA pLKO.1 45 CDS 100% 2.640 1.320 Y Tdpoz4 n/a
10 TRCN0000242301 AGGAGATGATGGGCTTCATTT pLKO_005 719 CDS 100% 13.200 6.600 Y Spopfm3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207272.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.