Transcript: Mouse NM_207277.1

Mus musculus Myb/SANT-like DNA-binding domain containing 1 (Msantd1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Msantd1 (403174)
Length:
2793
CDS:
1682..2518

Additional Resources:

NCBI RefSeq record:
NM_207277.1
NBCI Gene record:
Msantd1 (403174)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207277.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000266762 CCCTCTGTACTTACCGTATAC pLKO_005 2182 CDS 100% 10.800 15.120 N Msantd1 n/a
2 TRCN0000266761 CTTCCAGTACAGGAAATTAAA pLKO_005 1990 CDS 100% 15.000 10.500 N Msantd1 n/a
3 TRCN0000283309 GCCTACTGGAGAAGATCATTG pLKO_005 2481 CDS 100% 10.800 7.560 N Msantd1 n/a
4 TRCN0000181366 CCTAGCCATTGATAGGATTCT pLKO.1 2056 CDS 100% 4.950 3.465 N Msantd1 n/a
5 TRCN0000136807 CACCAACATGACCTTCCAGTA pLKO.1 1978 CDS 100% 4.050 2.835 N MSANTD1 n/a
6 TRCN0000182247 CATGACAGATAGCGAGTCCAT pLKO.1 2014 CDS 100% 2.640 1.848 N Msantd1 n/a
7 TRCN0000265162 TCCATGGAGAGAATGCCAGGT pLKO_005 2519 CDS 100% 2.160 1.512 N Msantd1 n/a
8 TRCN0000181528 GAAGATCATTGCCAAGTCCAA pLKO.1 2491 CDS 100% 2.640 1.584 N Msantd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207277.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.