Transcript: Human NM_207308.2

Homo sapiens nucleoporin 210 like (NUP210L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
NUP210L (91181)
Length:
5913
CDS:
73..5739

Additional Resources:

NCBI RefSeq record:
NM_207308.2
NBCI Gene record:
NUP210L (91181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140425 GTCGGCTGCAACATTGGTTAT pLKO.1 5702 CDS 100% 10.800 15.120 N NUP210L n/a
2 TRCN0000140685 CCGGTTACATGGTCATCAGAT pLKO.1 2616 CDS 100% 4.950 6.930 N NUP210L n/a
3 TRCN0000139634 CCTCGGCACATTGAAGTGTTT pLKO.1 3298 CDS 100% 4.950 6.930 N NUP210L n/a
4 TRCN0000145191 GCATTGTTCCAGTACACATAT pLKO.1 1914 CDS 100% 13.200 9.240 N NUP210L n/a
5 TRCN0000142474 GCTACCAAGATGCCAGTTTAT pLKO.1 3628 CDS 100% 13.200 9.240 N NUP210L n/a
6 TRCN0000145362 GAGGGCTATGAAAGATAAGTT pLKO.1 5430 CDS 100% 5.625 3.938 N NUP210L n/a
7 TRCN0000145042 GAATTGGTTCTTAGCCACAAA pLKO.1 5176 CDS 100% 4.950 3.465 N NUP210L n/a
8 TRCN0000144972 GTAAAGTCTTTCAGGTCCATT pLKO.1 4961 CDS 100% 4.950 3.465 N NUP210L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.