Transcript: Human NM_207362.3

Homo sapiens KIAA1211 like (KIAA1211L), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
KIAA1211L (343990)
Length:
3873
CDS:
299..3187

Additional Resources:

NCBI RefSeq record:
NM_207362.3
NBCI Gene record:
KIAA1211L (343990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207362.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142475 GCCCTTTCTCACGACAGTATT pLKO.1 566 CDS 100% 13.200 18.480 N KIAA1211L n/a
2 TRCN0000141452 CCATAAAGGTCTCTGTCGTGT pLKO.1 831 CDS 100% 2.640 3.696 N KIAA1211L n/a
3 TRCN0000142775 CGGATTAAAGCTCTGCAGTTA pLKO.1 656 CDS 100% 4.950 3.960 N KIAA1211L n/a
4 TRCN0000141553 CCAGTGGCTGACTTCAGTTAT pLKO.1 911 CDS 100% 13.200 9.240 N KIAA1211L n/a
5 TRCN0000141552 CAGACGAGGAATGAGGTCATT pLKO.1 470 CDS 100% 4.950 3.465 N KIAA1211L n/a
6 TRCN0000141211 CCTGTGAAGCAAGCTGACTTT pLKO.1 2906 CDS 100% 4.950 3.465 N KIAA1211L n/a
7 TRCN0000143455 GAAACAAAGTCAGACGAGGAA pLKO.1 460 CDS 100% 2.640 1.848 N KIAA1211L n/a
8 TRCN0000142663 GCTGACTTCAGTTATCCTGCA pLKO.1 917 CDS 100% 2.160 1.512 N KIAA1211L n/a
9 TRCN0000122121 CCCAGAAACAAGAACAACATT pLKO.1 3383 3UTR 100% 5.625 3.375 N KIAA1211L n/a
10 TRCN0000142412 GAGGACAGCACAGGAAAGAAA pLKO.1 356 CDS 100% 5.625 3.375 N KIAA1211L n/a
11 TRCN0000141858 GCAGTGATGATGGAGAAGGAA pLKO.1 3056 CDS 100% 3.000 1.500 Y KIAA1211L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207362.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.