Transcript: Human NM_207365.4

Homo sapiens arylacetamide deacetylase like 2 (AADACL2), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
AADACL2 (344752)
Length:
5060
CDS:
110..1315

Additional Resources:

NCBI RefSeq record:
NM_207365.4
NBCI Gene record:
AADACL2 (344752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207365.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159354 GTATGTAAGTTGGCTGGATAA pLKO.1 1285 CDS 100% 10.800 15.120 N AADACL2 n/a
2 TRCN0000159803 GCGTATTATGAGATATGAAGA pLKO.1 268 CDS 100% 4.950 6.930 N AADACL2 n/a
3 TRCN0000162527 CTTCGAAATGTTGGAGTCCAA pLKO.1 1169 CDS 100% 2.640 3.696 N AADACL2 n/a
4 TRCN0000160650 CCTTACATAGTGGATTGTAAT pLKO.1 1338 3UTR 100% 1.320 1.848 N AADACL2 n/a
5 TRCN0000166519 CCTGAATAGATGGACGGCAAA pLKO.1 490 CDS 100% 4.050 3.240 N AADACL2 n/a
6 TRCN0000162610 CTGGATTATACCCAACCACTT pLKO.1 311 CDS 100% 4.050 3.240 N AADACL2 n/a
7 TRCN0000161300 GTCTTACTTTACCCTGGCTTA pLKO.1 755 CDS 100% 4.050 3.240 N AADACL2 n/a
8 TRCN0000158600 CTGGCTTACAGATAACAGATT pLKO.1 768 CDS 100% 4.950 3.465 N AADACL2 n/a
9 TRCN0000160254 CGTGAGCTTATATTTCACCAA pLKO.1 856 CDS 100% 2.640 1.848 N AADACL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207365.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.