Transcript: Human NM_207372.2

Homo sapiens SH2 domain containing 4B (SH2D4B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
SH2D4B (387694)
Length:
3983
CDS:
431..1504

Additional Resources:

NCBI RefSeq record:
NM_207372.2
NBCI Gene record:
SH2D4B (387694)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207372.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414177 TCGGGACAGAAATTGCTAATA pLKO_005 1690 3UTR 100% 13.200 18.480 N SH2D4B n/a
2 TRCN0000440763 TGACAAGCCCTACGAAGAGAT pLKO_005 694 CDS 100% 4.950 6.930 N SH2D4B n/a
3 TRCN0000168275 CCCTGGAACTTACTAGCATTA pLKO.1 2551 3UTR 100% 10.800 7.560 N SH2D4B n/a
4 TRCN0000443612 GAGTGACAAGCACATCCAATG pLKO_005 619 CDS 100% 6.000 4.200 N SH2D4B n/a
5 TRCN0000168546 CCAGACTACCATCTGTTGTTT pLKO.1 1482 CDS 100% 5.625 3.938 N SH2D4B n/a
6 TRCN0000168591 GTTTCAGGAGGAGAGTTACTT pLKO.1 1431 CDS 100% 5.625 3.938 N SH2D4B n/a
7 TRCN0000172698 GCAGAAGCACATCCTCTTCTA pLKO.1 496 CDS 100% 0.495 0.347 N SH2D4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207372.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.