Transcript: Human NM_207386.4

Homo sapiens shisa family member 6 (SHISA6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
SHISA6 (388336)
Length:
7625
CDS:
211..1866

Additional Resources:

NCBI RefSeq record:
NM_207386.4
NBCI Gene record:
SHISA6 (388336)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207386.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268551 ATCAATATAACCATCCGATTT pLKO_005 1112 CDS 100% 10.800 15.120 N SHISA6 n/a
2 TRCN0000172602 GCTATCGATACCTCTCCCAAA pLKO.1 919 CDS 100% 4.050 5.670 N SHISA6 n/a
3 TRCN0000268496 GACAAGGAGTTCGAGTGTAAC pLKO_005 523 CDS 100% 10.800 8.640 N SHISA6 n/a
4 TRCN0000283717 CAAGGAGGCTGACGAGTATTA pLKO_005 1320 CDS 100% 13.200 9.240 N SHISA6 n/a
5 TRCN0000268497 AGTGCCTCCAATAACTCATAC pLKO_005 1708 CDS 100% 10.800 7.560 N SHISA6 n/a
6 TRCN0000268550 GGCCTGGTCCAATACACTTAG pLKO_005 2039 3UTR 100% 10.800 7.560 N SHISA6 n/a
7 TRCN0000172564 GAAGCCACGGATGAACAACAT pLKO.1 1164 CDS 100% 4.950 3.465 N SHISA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207386.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.