Transcript: Human NM_207391.3

Homo sapiens regulator of G protein signaling 9 binding protein (RGS9BP), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RGS9BP (388531)
Length:
2453
CDS:
417..1124

Additional Resources:

NCBI RefSeq record:
NM_207391.3
NBCI Gene record:
RGS9BP (388531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415271 ACCGTCACAGTGACCCTAGAT pLKO_005 1379 3UTR 100% 4.950 6.930 N RGS9BP n/a
2 TRCN0000144453 CGTGTACTATGAAAGCTGTTA pLKO.1 2279 3UTR 100% 4.950 6.930 N RGS9BP n/a
3 TRCN0000143740 GCAGTTCATACAAAGGGCTTT pLKO.1 1664 3UTR 100% 4.050 5.670 N RGS9BP n/a
4 TRCN0000429108 CAACAAGACGACTGCGTGCTA pLKO_005 455 CDS 100% 2.640 3.696 N RGS9BP n/a
5 TRCN0000141008 CGAGATGATCGACAACATGGA pLKO.1 890 CDS 100% 2.640 3.696 N RGS9BP n/a
6 TRCN0000415736 GGGACGCTGTTTGGTTCTATG pLKO_005 1543 3UTR 100% 10.800 8.640 N RGS9BP n/a
7 TRCN0000121800 CCCTCCGAGTTAATGAGTTAA pLKO.1 1400 3UTR 100% 13.200 9.240 N RGS9BP n/a
8 TRCN0000143074 GATCGACAACATGGAGATGAA pLKO.1 896 CDS 100% 4.950 3.465 N RGS9BP n/a
9 TRCN0000121749 CAACATGGAGATGAAGGTCAA pLKO.1 902 CDS 100% 4.050 2.835 N RGS9BP n/a
10 TRCN0000141294 CCAGAGTGTTTGAACCTCCTT pLKO.1 1994 3UTR 100% 2.640 1.848 N RGS9BP n/a
11 TRCN0000142156 GACAACATGGAGATGAAGGTC pLKO.1 900 CDS 100% 2.640 1.848 N RGS9BP n/a
12 TRCN0000435716 CCTTCAGGTGGGCGAGATGAT pLKO_005 878 CDS 100% 1.650 1.155 N RGS9BP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.