Transcript: Human NM_207407.2

Homo sapiens transmembrane serine protease 11F (TMPRSS11F), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
TMPRSS11F (389208)
Length:
2077
CDS:
50..1366

Additional Resources:

NCBI RefSeq record:
NM_207407.2
NBCI Gene record:
TMPRSS11F (389208)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430129 AGCTGATACTCCTGCGTATTT pLKO_005 1403 3UTR 100% 13.200 18.480 N TMPRSS11F n/a
2 TRCN0000118314 GATTGCCTCAAAGACTGGTAT pLKO.1 1342 CDS 100% 4.950 6.930 N TMPRSS11F n/a
3 TRCN0000118313 CCTCCCAGACTCATCTATAAA pLKO.1 988 CDS 100% 15.000 10.500 N TMPRSS11F n/a
4 TRCN0000118312 GCTTGTGATACTTCCTAATAA pLKO.1 1610 3UTR 100% 15.000 10.500 N TMPRSS11F n/a
5 TRCN0000416656 CAATTGTCTTTGACCATAAAC pLKO_005 521 CDS 100% 13.200 9.240 N TMPRSS11F n/a
6 TRCN0000433934 CACCCGCAGTGAAACGAAATG pLKO_005 855 CDS 100% 10.800 7.560 N TMPRSS11F n/a
7 TRCN0000421232 TAGCAATTGTAGCAATCATAG pLKO_005 153 CDS 100% 10.800 7.560 N TMPRSS11F n/a
8 TRCN0000118316 CCTCTGGTTTATGATAATCAT pLKO.1 1223 CDS 100% 5.625 3.938 N TMPRSS11F n/a
9 TRCN0000118315 TGTCTAGGATATTTCGACATT pLKO.1 333 CDS 100% 4.950 3.465 N TMPRSS11F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.