Transcript: Mouse NM_207561.2

Mus musculus olfactory receptor 1040 (Olfr1040), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr1040 (404323)
Length:
942
CDS:
1..942

Additional Resources:

NCBI RefSeq record:
NM_207561.2
NBCI Gene record:
Olfr1040 (404323)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207561.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000203784 CTCTGGTGATTGTGGTCATTT pLKO.1 629 CDS 100% 13.200 7.920 N Olfr1040 n/a
2 TRCN0000203050 GTCATTTCTTACATCTGCATT pLKO.1 643 CDS 100% 4.950 2.970 N Olfr1040 n/a
3 TRCN0000188306 CCATCTGACTTCCATCACCAT pLKO.1 729 CDS 100% 2.640 1.584 N Olfr1040 n/a
4 TRCN0000184989 CCATTCTCTGAACACAGATAA pLKO.1 795 CDS 100% 13.200 6.600 Y Olfr1039 n/a
5 TRCN0000203194 GCATTCGTTGATTTCTGTTAT pLKO.1 199 CDS 100% 13.200 6.600 Y Olfr1039 n/a
6 TRCN0000203100 GTAATGGCTTATGACAGATAT pLKO.1 349 CDS 100% 13.200 6.600 Y Olfr1039 n/a
7 TRCN0000203066 GAGCTGATGTTGCTAATCATT pLKO.1 586 CDS 100% 5.625 2.813 Y Olfr1039 n/a
8 TRCN0000185463 GAAATGTACTTGCTGTCAGTA pLKO.1 331 CDS 100% 4.950 2.475 Y Olfr1039 n/a
9 TRCN0000185445 GCACATACATTTATGGATTCA pLKO.1 440 CDS 100% 4.950 2.475 Y Olfr1040 n/a
10 TRCN0000204105 GCTTCACACACCCATGTACTT pLKO.1 162 CDS 100% 4.950 2.475 Y Olfr1039 n/a
11 TRCN0000188674 GCATTCTCTTTGCCATCCTGA pLKO.1 659 CDS 100% 2.640 1.320 Y Olfr1040 n/a
12 TRCN0000204815 GCTCTCTGGTGATTGTGGTTA pLKO.1 626 CDS 100% 4.950 2.475 Y Olfr1042 n/a
13 TRCN0000197364 CCCAAGTCAAGCCATTCTCAA pLKO.1 784 CDS 100% 4.950 2.475 Y OR2A12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207561.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.