Transcript: Mouse NM_207571.2

Mus musculus olfactory receptor 1355 (Olfr1355), mRNA.

Source:
NCBI, updated 2013-04-18
Taxon:
Mus musculus (mouse)
Gene:
Olfr1355 (257734)
Length:
1148
CDS:
216..1148

Additional Resources:

NCBI RefSeq record:
NM_207571.2
NBCI Gene record:
Olfr1355 (257734)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188402 CCTGTTCTATTGGGAGCCATT pLKO.1 825 CDS 100% 4.050 2.835 N Olfr1355 n/a
2 TRCN0000184918 CCATTGTATTACACAGTCATT pLKO.1 603 CDS 100% 4.950 2.970 N Olfr1355 n/a
3 TRCN0000185227 CCAAAGATGCTGGTAAATATA pLKO.1 453 CDS 100% 15.000 7.500 Y Olfr1355 n/a
4 TRCN0000204109 GCCTTCTTACAGAGCTCAATT pLKO.1 684 CDS 100% 13.200 6.600 Y Olfr1355 n/a
5 TRCN0000188004 GCTTATCAAGCCACCTCATAA pLKO.1 793 CDS 100% 13.200 6.600 Y Olfr8 n/a
6 TRCN0000203731 CCACTTCTTCTGTGAGCTTAA pLKO.1 743 CDS 100% 10.800 5.400 Y Olfr1355 n/a
7 TRCN0000187310 CCACACCTTCAATTCCTCATT pLKO.1 279 CDS 100% 4.950 2.475 Y Olfr1355 n/a
8 TRCN0000188222 CCCACTTCTTCTGTGAGCTTA pLKO.1 742 CDS 100% 4.950 2.475 Y Olfr1355 n/a
9 TRCN0000187685 CCATGTACTTCTTCCTTGCTA pLKO.1 391 CDS 100% 3.000 1.500 Y Olfr8 n/a
10 TRCN0000188371 CCTGCTCATCATCATGGTCAT pLKO.1 344 CDS 100% 4.050 2.025 Y Olfr8 n/a
11 TRCN0000188178 CCCATGTACTTCTTCCTTGCA pLKO.1 390 CDS 100% 2.640 1.320 Y Olfr525 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.