Transcript: Mouse NM_207574.1

Mus musculus olfactory receptor 1383 (Olfr1383), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr1383 (404337)
Length:
936
CDS:
1..936

Additional Resources:

NCBI RefSeq record:
NM_207574.1
NBCI Gene record:
Olfr1383 (404337)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207574.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188555 CTGGCCTCAACTGGAACATAT pLKO.1 57 CDS 100% 13.200 7.920 N Olfr1383 n/a
2 TRCN0000186157 CCTCAACTGGAACATATCTTT pLKO.1 61 CDS 100% 5.625 3.375 N Olfr1383 n/a
3 TRCN0000187099 CATCATCACAATCTCACGAAT pLKO.1 132 CDS 100% 4.950 2.970 N Olfr1383 n/a
4 TRCN0000204687 GCCATGTACACCTATCTCCAA pLKO.1 760 CDS 100% 2.640 1.584 N Olfr1383 n/a
5 TRCN0000189352 CCATCACCTGAACCACTTCTT pLKO.1 510 CDS 100% 4.950 2.475 Y Olfr1383 n/a
6 TRCN0000186271 CTTCCTTAACAACCTCTCTTT pLKO.1 183 CDS 100% 4.950 2.475 Y Olfr1383 n/a
7 TRCN0000187344 CCAGTTCTTCATAGTGCTCTT pLKO.1 297 CDS 100% 4.050 2.025 Y Olfr1383 n/a
8 TRCN0000186509 GCAGTGTTGAAGATCAAGTCA pLKO.1 667 CDS 100% 3.000 1.500 Y Olfr1384 n/a
9 TRCN0000188506 CCACTTCTTCTGTGAGATGCT pLKO.1 522 CDS 100% 2.640 1.320 Y Olfr1384 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207574.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.