Transcript: Mouse NM_207624.5

Mus musculus angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 (Ace), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ace (11421)
Length:
4906
CDS:
38..3976

Additional Resources:

NCBI RefSeq record:
NM_207624.5
NBCI Gene record:
Ace (11421)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207624.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031143 CGCCATGATGAATTACTTCAA pLKO.1 3637 CDS 100% 4.950 3.960 N Ace n/a
2 TRCN0000031142 CCAAGTGTTGTTGAACGAGTA pLKO.1 2032 CDS 100% 4.050 3.240 N Ace n/a
3 TRCN0000031141 CCCTGGAACCTGATCTAACAA pLKO.1 2346 CDS 100% 5.625 3.938 N Ace n/a
4 TRCN0000031139 CCAGTATTTCATGCAGTACAA pLKO.1 3031 CDS 100% 4.950 3.465 N Ace n/a
5 TRCN0000031140 CCCAATATAGATGCCACGGAA pLKO.1 2756 CDS 100% 2.640 1.848 N Ace n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207624.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.