Transcript: Mouse NM_207665.1

Mus musculus olfactory receptor 1537 (Olfr1537), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Olfr1537 (257959)
Length:
945
CDS:
1..945

Additional Resources:

NCBI RefSeq record:
NM_207665.1
NBCI Gene record:
Olfr1537 (257959)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207665.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186615 GTTCAGGTGCATTCACGTATT pLKO.1 767 CDS 100% 10.800 6.480 N Olfr1537 n/a
2 TRCN0000186651 GAGCTTTCTGACAGAGATGAA pLKO.1 258 CDS 100% 4.950 2.970 N Olfr1537 n/a
3 TRCN0000186629 GCACACACCCATGTACTATTT pLKO.1 174 CDS 100% 13.200 6.600 Y Olfr951 n/a
4 TRCN0000204567 CTCAGCAGTCTGTCCTTCATT pLKO.1 196 CDS 100% 5.625 2.813 Y Olfr1537 n/a
5 TRCN0000203655 CCACATCTCTGCTGTTGCTAT pLKO.1 738 CDS 100% 4.950 2.475 Y Olfr242 n/a
6 TRCN0000203151 GACCATTATTACTTCCTACAT pLKO.1 645 CDS 100% 4.950 2.475 Y Olfr242 n/a
7 TRCN0000204624 GCACAGTGACTGAGTTCTTCT pLKO.1 29 CDS 100% 4.950 2.475 Y Olfr1537 n/a
8 TRCN0000185418 GTTCTGCAATTTAGATGTGAT pLKO.1 510 CDS 100% 4.950 2.475 Y Olfr27 n/a
9 TRCN0000185451 GCTGACCATTATTACTTCCTA pLKO.1 642 CDS 100% 3.000 1.500 Y Olfr951 n/a
10 TRCN0000186116 CCCATGTACTATTTCCTCAGT pLKO.1 181 CDS 100% 2.640 1.320 Y Olfr937 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207665.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.