Transcript: Mouse NM_207683.2

Mus musculus phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma (Pik3c2g), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-03
Taxon:
Mus musculus (mouse)
Gene:
Pik3c2g (18705)
Length:
6358
CDS:
434..4954

Additional Resources:

NCBI RefSeq record:
NM_207683.2
NBCI Gene record:
Pik3c2g (18705)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368726 CAGGTGCTACGCGGATCTTAT pLKO_005 4472 CDS 100% 13.200 18.480 N Pik3c2g n/a
2 TRCN0000024676 GACCCAACTTACAATGAAATT pLKO.1 4781 CDS 100% 13.200 18.480 N Pik3c2g n/a
3 TRCN0000024678 CGGATCTTATGAAGTTGCAAA pLKO.1 4483 CDS 100% 4.950 6.930 N Pik3c2g n/a
4 TRCN0000229598 GATATGCAAATGATCACTTAT pLKO_005 3461 CDS 100% 13.200 9.240 N Pik3c2g n/a
5 TRCN0000229599 GGGAGTCTGTGACCGACATAA pLKO_005 3703 CDS 100% 13.200 9.240 N Pik3c2g n/a
6 TRCN0000229597 TCGGGATGCTTGCTCGTATTT pLKO_005 3280 CDS 100% 13.200 9.240 N Pik3c2g n/a
7 TRCN0000361340 TTGGGTCATGCGCAAACATTT pLKO_005 3782 CDS 100% 13.200 9.240 N Pik3c2g n/a
8 TRCN0000361409 AGCGTATGCATTACTGCTTAA pLKO_005 4966 3UTR 100% 10.800 7.560 N Pik3c2g n/a
9 TRCN0000024674 CCTGAATAAGACCAGGACAAT pLKO.1 4210 CDS 100% 4.950 3.465 N Pik3c2g n/a
10 TRCN0000024675 GCTGACAAAGTCAGGTCACAT pLKO.1 3736 CDS 100% 4.950 3.465 N Pik3c2g n/a
11 TRCN0000024677 CCTCAGAGAAAGGATGTGCTA pLKO.1 3167 CDS 100% 2.640 1.848 N Pik3c2g n/a
12 TRCN0000361410 GAACCCGGCACTGTGCATAAA pLKO_005 3250 CDS 100% 13.200 7.920 N Pik3c2g n/a
13 TRCN0000368793 TGTTGTGAATTGCAATGTAAT pLKO_005 5177 3UTR 100% 13.200 7.920 N Pik3c2g n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.