Transcript: Mouse NM_207688.2

Mus musculus espin (Espn), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Espn (56226)
Length:
1890
CDS:
44..1645

Additional Resources:

NCBI RefSeq record:
NM_207688.2
NBCI Gene record:
Espn (56226)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247147 ACGAGACATTCTTCGGAAGAA pLKO_005 1453 CDS 100% 4.950 6.930 N Espn n/a
2 TRCN0000191369 CACCAAATCTTTCAACATGAT pLKO.1 1000 CDS 100% 4.950 3.960 N Espn n/a
3 TRCN0000247150 GAGCTTCTGGCTGAGATAAAG pLKO_005 1043 CDS 100% 13.200 9.240 N Espn n/a
4 TRCN0000247146 AGGAAATACAGAGGGCGAAAG pLKO_005 1527 CDS 100% 6.000 4.200 N Espn n/a
5 TRCN0000247149 TTGCGTGTAGCCTCACAAGTT pLKO_005 1664 3UTR 100% 4.950 3.465 N Espn n/a
6 TRCN0000137898 GAGCTACATGGACATGCTGAA pLKO.1 286 CDS 100% 4.050 2.835 N ESPN n/a
7 TRCN0000201772 GAGACGAGACATTCTTCGGAA pLKO.1 1450 CDS 100% 2.640 1.848 N Espn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.