Transcript: Mouse NM_212438.3

Mus musculus widely-interspaced zinc finger motifs (Wiz), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Wiz (22404)
Length:
3903
CDS:
59..2929

Additional Resources:

NCBI RefSeq record:
NM_212438.3
NBCI Gene record:
Wiz (22404)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_212438.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305321 GAAGAGTGGGTACGGCATTTA pLKO_005 2810 CDS 100% 13.200 18.480 N Wiz n/a
2 TRCN0000253786 AGCCCACAATGCCACGGAAAT pLKO_005 3491 3UTR 100% 10.800 7.560 N WIZ n/a
3 TRCN0000124556 CTGTGGTGAGTTCTTTGAGAA pLKO.1 1114 CDS 100% 4.950 3.465 N Wiz n/a
4 TRCN0000309309 CTGTGGTGAGTTCTTTGAGAA pLKO_005 1114 CDS 100% 4.950 3.465 N Wiz n/a
5 TRCN0000124555 GCAGGTTCTGTGAAGTGGAAT pLKO.1 2766 CDS 100% 4.950 3.465 N Wiz n/a
6 TRCN0000349240 GCAGGTTCTGTGAAGTGGAAT pLKO_005 2766 CDS 100% 4.950 3.465 N Wiz n/a
7 TRCN0000124554 GCTCCCTAGATCTTTCACTTT pLKO.1 3698 3UTR 100% 4.950 3.465 N Wiz n/a
8 TRCN0000309308 GCTCCCTAGATCTTTCACTTT pLKO_005 3698 3UTR 100% 4.950 3.465 N Wiz n/a
9 TRCN0000124558 CTGATCTTCACATCTCACCTT pLKO.1 1359 CDS 100% 2.640 1.848 N Wiz n/a
10 TRCN0000309307 CTGATCTTCACATCTCACCTT pLKO_005 1359 CDS 100% 2.640 1.848 N Wiz n/a
11 TRCN0000124557 CCTGGGCCAATCTACGGAGAT pLKO.1 548 CDS 100% 1.350 0.945 N Wiz n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_212438.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.