Transcript: Human NM_212550.5

Homo sapiens biogenesis of lysosomal organelles complex 1 subunit 3 (BLOC1S3), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
BLOC1S3 (388552)
Length:
2561
CDS:
58..666

Additional Resources:

NCBI RefSeq record:
NM_212550.5
NBCI Gene record:
BLOC1S3 (388552)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_212550.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245953 CCCTTGGATAATGCTTTATAT pLKO_005 806 3UTR 100% 15.000 10.500 N BLOC1S3 n/a
2 TRCN0000245954 GTCCAGCTGCCCGGTTAATTT pLKO_005 1162 3UTR 100% 15.000 10.500 N BLOC1S3 n/a
3 TRCN0000245952 TTGGCTCCTGGATGCTATAAA pLKO_005 2303 3UTR 100% 15.000 10.500 N BLOC1S3 n/a
4 TRCN0000245955 TCCCAACCTGACTGCAATTTG pLKO_005 680 3UTR 100% 13.200 9.240 N BLOC1S3 n/a
5 TRCN0000245951 TACTGTCTCCATCCTACTTAC pLKO_005 1959 3UTR 100% 10.800 7.560 N BLOC1S3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_212550.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.