Transcript: Human NM_212556.3

Homo sapiens ankyrin repeat and SOCS box containing 18 (ASB18), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
ASB18 (401036)
Length:
2821
CDS:
1..1401

Additional Resources:

NCBI RefSeq record:
NM_212556.3
NBCI Gene record:
ASB18 (401036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_212556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118354 CGTGGTGTTTGAGATCAATAA pLKO.1 258 CDS 100% 13.200 10.560 N ASB18 n/a
2 TRCN0000118353 ACGTGGTGTTTGAGATCAATA pLKO.1 257 CDS 100% 13.200 9.240 N ASB18 n/a
3 TRCN0000118352 GCCCAGGAATCAGTCTTGTTT pLKO.1 2455 3UTR 100% 5.625 3.938 N ASB18 n/a
4 TRCN0000118356 GAGATGGAATGGCAGGTGAAA pLKO.1 283 CDS 100% 4.950 3.465 N ASB18 n/a
5 TRCN0000118355 GAGTCCTGGAAGGAAGTGATT pLKO.1 1177 CDS 100% 4.950 3.465 N ASB18 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2716 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2716 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_212556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.