Transcript: Human NM_212558.3

Homo sapiens transmembrane protein 215 (TMEM215), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TMEM215 (401498)
Length:
5342
CDS:
325..1032

Additional Resources:

NCBI RefSeq record:
NM_212558.3
NBCI Gene record:
TMEM215 (401498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_212558.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428208 AGCCTTCACACTGTTAGAAAT pLKO_005 1113 3UTR 100% 13.200 9.240 N TMEM215 n/a
2 TRCN0000412461 GCTTATCACACTTGGTATTTG pLKO_005 1497 3UTR 100% 13.200 9.240 N TMEM215 n/a
3 TRCN0000444710 CAAAGGTGGCTGGATTGATAG pLKO_005 1043 3UTR 100% 10.800 7.560 N TMEM215 n/a
4 TRCN0000173031 CCCAGGACAGTATCATCGTTT pLKO.1 923 CDS 100% 4.950 3.465 N TMEM215 n/a
5 TRCN0000168002 CCTCGTCTTTGGTTTCATGTT pLKO.1 384 CDS 100% 4.950 3.465 N TMEM215 n/a
6 TRCN0000172527 CTTCCGGAAACCCAAAGACAA pLKO.1 570 CDS 100% 4.950 3.465 N TMEM215 n/a
7 TRCN0000172566 GCCTGAGGATAGCATCTTCTT pLKO.1 897 CDS 100% 4.950 3.465 N TMEM215 n/a
8 TRCN0000184051 CATCGTTTGCTCCTACAAGCA pLKO.1 936 CDS 100% 2.640 1.848 N Tmem215 n/a
9 TRCN0000420587 ACAAGCAGAACAGCCCGTATG pLKO_005 950 CDS 100% 6.000 3.600 N TMEM215 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_212558.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.